View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14052_low_8 (Length: 295)
Name: NF14052_low_8
Description: NF14052
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14052_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 65 - 287
Target Start/End: Complemental strand, 39428297 - 39428075
Alignment:
| Q |
65 |
ccaatgtatgtatatatgttactccagtgatggatgctgttttgttttcatttaaccttgatcgcgtattcatgttgaaatttcctaaagaaagcttctt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39428297 |
ccaatgtatgtatatatgttactccagtgatggatgctgttttgttttcatttaaccttgatcgcgtattcatgttgaaatttcctaaagaaagcttctt |
39428198 |
T |
 |
| Q |
165 |
gtttgttttgtttttcacaggtgtgagtgaatgctacttttgaattatggcttttaagggttctgataactcaaatgcgagcaatccagtttcttatgac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39428197 |
ttttgttttgtttttcacaggtgtgagtgaatgctacttttgaattatggcttttaagggttctgataactcaaatgcgagcaatcctgtttcttatgac |
39428098 |
T |
 |
| Q |
265 |
gatgctgattatgatgatgatgt |
287 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39428097 |
gatgctgattatgatgatgatgt |
39428075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 248 - 287
Target Start/End: Original strand, 39142776 - 39142815
Alignment:
| Q |
248 |
atccagtttcttatgacgatgctgattatgatgatgatgt |
287 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39142776 |
atccagtttcttatgacgacgcagattatgatgatgatgt |
39142815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 248 - 287
Target Start/End: Original strand, 39142845 - 39142884
Alignment:
| Q |
248 |
atccagtttcttatgacgatgctgattatgatgatgatgt |
287 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39142845 |
atccagtttcttatgacgacgcagattatgatgatgatgt |
39142884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University