View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14053_low_2 (Length: 412)

Name: NF14053_low_2
Description: NF14053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14053_low_2
NF14053_low_2
[»] chr2 (1 HSPs)
chr2 (306-392)||(17902254-17902340)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 306 - 392
Target Start/End: Original strand, 17902254 - 17902340
Alignment:
306 acagtatttttctaaatccgtgcaatattttttagcaaaaaacaaaataatcaagacaaccttaacatgcaatcccatttagaaaga 392  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17902254 acagtatttttctaaatccatgcaatattttttagcaaaaaacaaaataatcaagacaaccttaacatgcaatcccatttagaaaga 17902340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University