View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14055_low_12 (Length: 221)
Name: NF14055_low_12
Description: NF14055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14055_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 8006249 - 8006459
Alignment:
| Q |
1 |
attatttttcaacatnnnnnnntgaaaatttgggtggaaaacaattaaaatatcccgaaccattaataatttggtggaaaacaaataaaatatcctcaga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006249 |
attatttttcaacataaaaaaatgaaaatttgggtggaaaacaattaaaatatcccgaaccattaataatttggtggaaaacaaataaaatatcctcaga |
8006348 |
T |
 |
| Q |
101 |
agctgattatggcttcaccgttgtattgttcatgtgaaaaatgac------attagaatttagaaattttcaaagtataatcacttatcgcaaatttaca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8006349 |
agctgattatggcttcaccgttgtattgttcatgtgaaaaatgacattagaattagaatttagaaattttcaaagtataatcacttatcgcaaatttaca |
8006448 |
T |
 |
| Q |
195 |
aaatttatatg |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
8006449 |
aaatttatatg |
8006459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University