View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14055_low_13 (Length: 219)

Name: NF14055_low_13
Description: NF14055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14055_low_13
NF14055_low_13
[»] chr5 (1 HSPs)
chr5 (1-217)||(13891195-13891411)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 13891195 - 13891411
Alignment:
1 ttactgaaggtgctgatgatgtctttgttggggtgaggtttaatggatgatgatagaaatgttgaatgaaagtttttgttgttctttggttaatgatata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13891195 ttactgaaggtgctgatgatgtctttgttggggtgaggtttaatggatgatgatagaaatgttgaatgaaagtttttgttgttctttggttaatgatata 13891294  T
101 ggcaagaagtgtgtagtgttgttgttagaaaatgttttgcatagatagattttgggaggnnnnnnntgactgtaatggaggttgatagtatagtttttga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||| ||||||||||||||||||||||||||    
13891295 ggcaagaagtgtgtagtgttgttgttagaaaatgttttgcatagatagattttgggaggaaaaaaatgactgtgatggaggttgatagtatagtttttga 13891394  T
201 attgatgatgtccatct 217  Q
    |||||| |||| |||||    
13891395 attgattatgtgcatct 13891411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University