View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14056_high_6 (Length: 382)
Name: NF14056_high_6
Description: NF14056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14056_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 11 - 366
Target Start/End: Complemental strand, 10230197 - 10229843
Alignment:
| Q |
11 |
cacagatcttctacgattcagtttgtannnnnnnctacaatgtcctccgccctcctcacattcctagagctcgtaggtttgagaaatattacagtttgag |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10230197 |
cacagatcttctacgattcagtttgtatttttttctacaatgtcctccgccctcctcacattcctagagctcgtaggtttgagaaatattacagtttgag |
10230098 |
T |
 |
| Q |
111 |
agatacaaaaatcggttctgctgtgaatgaggtaattcagctttataatatgggttttaacttttagttgaataatagacactaacttgctcttggtatc |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10230097 |
agatacaaaaatcagttctgctgtgaatgaggtaattcagatttataatatgggttttaacttt-agttgaataatagacactaacttgctcttggtatc |
10229999 |
T |
 |
| Q |
211 |
ttgctagggcctattatatgatttactgtctagtttgcgggcttcgactactgatgctgctagttcatcttctgctactcgaaccatttcaaattcgacc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10229998 |
ttgctagggcctattatatgatttactgtctagtttgcgggcttcgactactgatgctgctagttcatcttctgctattcgaaccatttcaaattcgacc |
10229899 |
T |
 |
| Q |
311 |
atagcatcagttagtgaacttcttttaaggaatttctccaatgattgttacaatag |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10229898 |
atagcatcagttagtgaacttcttttaaggaatttctccaatgattgttacaatag |
10229843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University