View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14056_low_10 (Length: 340)
Name: NF14056_low_10
Description: NF14056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14056_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 5 - 326
Target Start/End: Complemental strand, 29677826 - 29677504
Alignment:
| Q |
5 |
aaaaggaaactttaggaaaagtacaagctgtagaggtaaaaggtggcagtgaagataatgatgttctgtttggagaaggggagcaatccagtcacatgat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677826 |
aaaaggaaactttaggaaaagtacaagctgtagaggtaaaaggtggcagtgaagataatgatgttctgtttggagaaggggagcaatccagtcacatgat |
29677727 |
T |
|
| Q |
105 |
gagaaaagagattgatcacgtgctataggtgggtcacttggagggggtgacacctggcacgtcttcacaggagattgaggatgaaccgggtcatgggttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
29677726 |
gagaaaagagattgatcacgtgctataggtgggtcacttggagggggtgacacctggcacgtcttcacaggagattggggatgaagcgggtcatgggttg |
29677627 |
T |
|
| Q |
205 |
gagttggtggataccgggtttcaaaaagcgggtacaatcccgatcatgatacaacccgacccaaactccgacccgattttagatccgaatgaggttattt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29677626 |
gagttggtggataccgggtttcaaaaagcgggtacaaccccgatcatgatgcaacccgacccaaactccgacccgactttagatccgaatgaggttattt |
29677527 |
T |
|
| Q |
305 |
tg-ggggttatccattgtctttg |
326 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
29677526 |
tggggggttatccattgtctttg |
29677504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University