View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14056_low_16 (Length: 296)
Name: NF14056_low_16
Description: NF14056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14056_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 31328918 - 31329173
Alignment:
| Q |
17 |
ataactgtggacgttgtggccttcccaaaaaaggacataactgtaatatcaaaacgccagtttccaccacaaccaccaccactacgccggtagattcatc |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31328918 |
ataattgtggacgttgtggccttcccaaaaaaggacataactgtaatatcaaaacgccagtttccaccacaaccaccaccactacgccggtagattcatc |
31329017 |
T |
|
| Q |
117 |
tttatctatcgtttctgtaccgtctgcggtctcggtgattcgtcaaccaccgtcgaatctccggcgagcgctttcgtttgacggtcttgacgatcgaggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31329018 |
tttatctatcgtttctgtaccgtctgcggtctcggtgattcgtcaaccaccgtcgaatctccggcgagcgctttcgtttgacggtcttgacgatcgaggc |
31329117 |
T |
|
| Q |
217 |
agtggacttgatctgttgaggcttgacgataaagcgtatggtgacggtgacggtga |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31329118 |
agtggacttgatctgttgaggcttgacgataaagcgtatggtgacggtgacggtga |
31329173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University