View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14056_low_17 (Length: 287)
Name: NF14056_low_17
Description: NF14056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14056_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 38623790 - 38624070
Alignment:
| Q |
1 |
acaacgaccactcaccatatatcaaggcnnnnnnntataatcatacgatgaaactgaagctccaataaacagcttctgaattgaatctacctcagctcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
38623790 |
acaacgaccactcaccatatatcaaggcaaaaaaatataatcatacgatgaaactgaagctccaaaaaacagcttctgcattgaatctacctcagctcgg |
38623889 |
T |
 |
| Q |
101 |
cattttaggaaaaaactattttcagcttacaatcaaacatgcatttagtctagtttagactttgagctatggagctgcaaatataaattgttttcacaaa |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623890 |
catgttaggaaaaaactattttcagcttacaatcaaacatgcatttagtctagtttagactttgagctatggagctgcaaatataaattgttttcacaaa |
38623989 |
T |
 |
| Q |
201 |
agacaacagtacataaatttcagtgtggtactttgtacagcctgtgtccttcaatctaaattgtttcataaaagatgttga |
281 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623990 |
agacaatagtacataaatttcactgtggtactttgtacagcctgtgtccttcaatctaaattgtttcataaaagatgttga |
38624070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University