View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14057_low_5 (Length: 274)
Name: NF14057_low_5
Description: NF14057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14057_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 7 - 260
Target Start/End: Complemental strand, 13113677 - 13113418
Alignment:
| Q |
7 |
tagataatactggataaacctcacaaatattactagcaggtgtgatgcaaagagcaaggtcaacatcaaatacaagtttgggatgtttgcagatgctttt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13113677 |
tagacaatactggataaacctcacaaatattactagcaagtgtgatgcaaagagcaaggtcaacatcaaatacaagtttgggatgtttgcagatgctttt |
13113578 |
T |
 |
| Q |
107 |
ctcaatgatgttgtcactactagttttaaggaaagatatttctattgtctttggtggggtttaagaaatttaaggtag------annnnnnnnnnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13113577 |
ctcaatgatgttgtcactactagttttaaggaaagatatttctattgtctttggtggggtttaagaaatttaaggtagatttttatttttatttttattt |
13113478 |
T |
 |
| Q |
201 |
ncttctgttctgtcatgtgtattccattcctacaattcatttctactaaaattacatttt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13113477 |
tcttctgttctgtcatgtgtattccattcctacaattcatttctactaaaattacatttt |
13113418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University