View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_high_10 (Length: 345)
Name: NF14058_high_10
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 25 - 321
Target Start/End: Complemental strand, 23204516 - 23204219
Alignment:
| Q |
25 |
tggagagtaggatttaaacactagctcatttatcctacttaaattgtatccactatgattttgtaccaaaatgtgatgttttggtatccatacatgatat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23204516 |
tggagagtaggatttaaacactagctcatttattctacttaaattgtatccactatgattttgtaccaaaatgtgatgttttggtatccatacatgatat |
23204417 |
T |
 |
| Q |
125 |
gtctgtatactgggttgaatcccctccttcaagtttgcccttaaaaaatataaaaggtatttccttgtgttgaatcatgccatgatatctcgcaagtact |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23204416 |
gtctgtatactgggttgaatcccctccttcaagtttgcccttaaaaaatataaaagatatttccttgtgttgaatcatgccatgatatctcacaagtact |
23204317 |
T |
 |
| Q |
225 |
gaagtgtaaggcaaataggttaaggtga-nnnnnnnngaagaagaataggttaagatgattagtagtggtcaaaagacaatggccgatttgcctcagc |
321 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
23204316 |
taagtgtaaggaaaataggttaaggtgatttttttttgaagaagaataggttaagatgattagtagtggtcaaaaggcaatgattgatttgcctcagc |
23204219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University