View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_high_24 (Length: 203)
Name: NF14058_high_24
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 16791372 - 16791284
Alignment:
| Q |
20 |
ttttttgaataaaaccaagttcacttaatttattttgttatt---tggtatggcaattgcattgattcgacacggtccctgctgcagca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16791372 |
ttttttgaataaaaccaagttcacttaatttattttgttaattggtggtagggcaattgcattgattcgacacggtccctgctgcagca |
16791284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 103 - 183
Target Start/End: Complemental strand, 16791223 - 16791143
Alignment:
| Q |
103 |
gcaacataggttcaaaattagttgataccaacactcaaaccaccccgctatgatggtatataaaattccaaacgccatttt |
183 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||| |||||| |
|
|
| T |
16791223 |
gcaacttaggttcaaaaccagttgatagcaacactcaaaccaccctgctatgattgtatataaaattccaaacgtcatttt |
16791143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University