View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_low_13 (Length: 327)
Name: NF14058_low_13
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 123 - 317
Target Start/End: Original strand, 11571438 - 11571639
Alignment:
| Q |
123 |
tattacaatttgagaacttctagagttgtctctattaatgtatgtaaaagctttatttttctt---------ctacttattgctttgctatcatgttann |
213 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||| || ||||| || |||||||||||||| |||| |||||| |
|
|
| T |
11571438 |
tattacaatttgaaaacttctagagatgtctctattaatgtatgtaaaagcatttttttttttttttgtgttctacttattgcttttctatgatgttatt |
11571537 |
T |
|
| Q |
214 |
nnnnnnncttatacattaattctatgttttttattttaggcacatgcaacaagttgtgttagcaaatctttgaaatggtggaagaagaacttgaaggcta |
313 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11571538 |
ttttt--catatacattaattctatgttttttattttaggcacatgcaacaagttgtgttagcaaatcattgaaatggtggaagaagaacttgaaggcta |
11571635 |
T |
|
| Q |
314 |
atat |
317 |
Q |
| |
|
|||| |
|
|
| T |
11571636 |
atat |
11571639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 88 - 126
Target Start/End: Original strand, 11571337 - 11571375
Alignment:
| Q |
88 |
gtccttcaagacatgttgaagcaaaatcaagcacctatt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11571337 |
gtccttcaagacatgttgaagcaaaatcaagcacctatt |
11571375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University