View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_low_16 (Length: 277)
Name: NF14058_low_16
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_low_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 277
Target Start/End: Original strand, 22720639 - 22720903
Alignment:
| Q |
13 |
catcaagtgatcctatcatacgcagcccagaaataccacatattcagcctcgatggccaattcgaccacctcctaattattaagtaaagacttgagaaca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22720639 |
catcaagtgatcctatcatacgcagcccagaaataccacatattcagcctcgatggccaattcgaccacctcctaattattaagtaaagacttaagaacg |
22720738 |
T |
|
| Q |
113 |
caccattttataacagatggtggtctgttagtggctcggactgagatcctaagagggcttaacttgctttcctttcggtttgattcggcttttcatttgt |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22720739 |
gaccattttataatagatggtggtctgttagtggctcggactgagatcctaagaggtcttaacttgctttcctttcggtttgattcggcttttcatttgt |
22720838 |
T |
|
| Q |
213 |
gtatcatcttggctgcgaatttgggggtgccatggtttgcagtgcatttgtcaagttatttcttt |
277 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
22720839 |
gcatcatcttggctgcgaatttgggggtgccatggtttgtagtgcatttgtcaagttattgcttt |
22720903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University