View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_low_18 (Length: 246)
Name: NF14058_low_18
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 43949847 - 43949716
Alignment:
| Q |
8 |
gagcagagagaatccggatctgtatttgcttttttactttagtgatttcccccaaaatagatccgttagtggttatcaaaatgatgaaaaataaacgtag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43949847 |
gagcagagagaatccggatctgtatttgcttttttactttagtgatttcccccaaaatagatccgttattggttatcaaaatgatgaaaaataaacgtag |
43949748 |
T |
 |
| Q |
108 |
ataggtaagagaatagtgtcacaaggatacaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43949747 |
ataggtaagagaatagtgtcacaaggatacaa |
43949716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University