View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_low_24 (Length: 237)
Name: NF14058_low_24
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_low_24 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 416970 - 416762
Alignment:
| Q |
1 |
aaacccttattggaagataggaaccctgaagaaggcagcttctgtgcctgctcttgtgcttgctcttgcaacttcgtgaccattgaaaagtggtcggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
416970 |
aaacccttattggaagataggaaccctgaagaaggcagcttctgtgcctgctcttg------------caacttcgtgaccattgaaaagtggtcggatt |
416883 |
T |
 |
| Q |
101 |
gagtagcaggtaatgaaataattggactaggaggggactctacaagtgaaaatggctgaacctgcacatgttcttgagactcagtggaattcactgacaa |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
416882 |
gagtagcaggtaatgaaataattagactaggaggggactctacaagtgataatggctgaacctgcacatgttcttgagactcagtggaattcactgacaa |
416783 |
T |
 |
| Q |
201 |
agaagaattcagagttgcatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
416782 |
agaagaattcagagttgcatt |
416762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University