View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14058_low_25 (Length: 220)
Name: NF14058_low_25
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14058_low_25 |
 |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0129 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 66 - 202
Target Start/End: Original strand, 15761 - 15897
Alignment:
| Q |
66 |
ggttacataatatgattgaacctacaacaaacacaactcatttttcattagtttgatttaattcgaatttcaagaggaatggtagcaaaaatcgaaccaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15761 |
ggttacataatatgattgaacctacaacaaacacaactcatttttcattagtttgatttaattcgaatttcaagaggaatggtagcaaaaatcgaaccaa |
15860 |
T |
 |
| Q |
166 |
atgaagtttactaagtcccacattaatgatacagttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15861 |
atgaagtttactaagtcccacattaatgatacagttt |
15897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University