View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14059_low_12 (Length: 212)
Name: NF14059_low_12
Description: NF14059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14059_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 47638451 - 47638635
Alignment:
| Q |
16 |
attctaaccagtggaagattaaattgcataacaaaagaaaggtgtatcacctgttactatttctctcaattcacaatactatcttttcatctcaaaatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47638451 |
attctaaccagtggaagattaaattgcataacaaaagaaaggtgtatcacctgttactatttctctcaattcacaatactatcttttcatctcaaaatgt |
47638550 |
T |
 |
| Q |
116 |
atatcatcaattcctcaacaacaacacaattga---ttcttcttcttcttctagcatcctttttaacttcactcgccttttcatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
47638551 |
atatcatcaattcctcaacaacaacacaattgattcttcttcttcttcttcttgcatccttgttaacttcactcaccttttcatt |
47638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University