View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1405_low_1 (Length: 367)
Name: NF1405_low_1
Description: NF1405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1405_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 84 - 268
Target Start/End: Original strand, 30385835 - 30386019
Alignment:
| Q |
84 |
atgaagtttcccagtcaatttgtctaaagtgtggcctcaaagcatcccacaaattcagcattcattgtagatccaacgatagcatactgtttcacactct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30385835 |
atgaagtttcccagtcaatttgtctaaagtgtggcctcaaagcatcccacaaattcagcattcattgtagatccaacgatagcatactgtttcacactct |
30385934 |
T |
|
| Q |
184 |
tccattatatcaaccctaacgaaaagatacacataactaaatgttcactttcctgtatcaacaaccagaaaattttaaatctgaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30385935 |
tccattatatcaaccctaacgaaaagatacacataactaaatgttcactttcctgtatcaacaaccagaaaaatttaaatttgaa |
30386019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University