View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1405_low_2 (Length: 341)
Name: NF1405_low_2
Description: NF1405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1405_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 94 - 332
Target Start/End: Complemental strand, 31607986 - 31607748
Alignment:
| Q |
94 |
acttcttgatccaaaatcttaaaaattggattgacgaaccatctttcgcatatatgttactcaactcacacattcacactcgaaacttcaatattaacat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607986 |
acttcttgatccaaaatcttaaaaattggattgacgaaccatctttcgcatatatgttactcaactcacacattcacactcgaaacttcaatattaacat |
31607887 |
T |
|
| Q |
194 |
agattactcatcaattttattgataggaattgaatgtctttggtgagaaatgtaaggaattattggacttatatctcgacgaagagggagcctcattctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31607886 |
agattactcatcaattttattgataggaaatgaatgtctttggtgagaaatgtaaggaattattggacttatatctcgacgaagagggagccgcattctt |
31607787 |
T |
|
| Q |
294 |
tctccatcaccccataatacataagcttcttccctatga |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31607786 |
tctccatcaccccataatacataagcttcttccccatga |
31607748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University