View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1405_low_5 (Length: 292)
Name: NF1405_low_5
Description: NF1405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1405_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 50 - 223
Target Start/End: Complemental strand, 47093815 - 47093638
Alignment:
| Q |
50 |
aatataatgattggacttaagtgtcaatgaactttagttgaaaccgaat----ggtaggcaagagtcaaagttcgaatcctaactcaatattattagccg |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47093815 |
aatataatgattggacttaagtgtcaatgaactttagttgaaaccgaatatatggtaggcaagagtcaaagttcgaatcctaactcaatattattagacg |
47093716 |
T |
|
| Q |
146 |
gattttacttatctatcaaccgaactctaaattattaaaacnnnnnnnaaataaactaaaatgaaatatattaccgat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47093715 |
gattttacttatctatcaaccgaactctaaattattaaaactttttttaaataaactaaaatgaaatatattaccgat |
47093638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University