View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1405_low_7 (Length: 281)
Name: NF1405_low_7
Description: NF1405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1405_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 63 - 244
Target Start/End: Complemental strand, 32618137 - 32617956
Alignment:
| Q |
63 |
gaaaaatgcaaagccatatctactattgttagctgttcaatttggttctgctggtatgttcatttttgccatggatgctatcaagaaaggcatgagccat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618137 |
gaaaaatgcaaagccatatctactattgttggctgttcaatttggttctgctggtatgttcatttttgccatggatgctatcaagaaaggcatgagccat |
32618038 |
T |
|
| Q |
163 |
tatgttttcatcgtttaccggaatgccatcgctgctgtaacgttagctcccttcgcatttcatctagaaaggtctctgctcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618037 |
tatgttttcatcgtttaccggaatgccatcgctgctgtaacgttagctcccttcgcatttcatctagaaaggtctctgctcc |
32617956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University