View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14060_high_13 (Length: 486)
Name: NF14060_high_13
Description: NF14060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14060_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 13 - 129
Target Start/End: Original strand, 49054930 - 49055046
Alignment:
| Q |
13 |
atcatcattctaaatgaagaatgtatgcggcctaacttttaattaacactttttgattcatagaatggaaaataaaatagttattattggctgcaatgca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49054930 |
atcatcattctaaatgaagaatgtatgcggcctaacttttaattaacactttttgattcatagaatggaaaataaaatagttattattggctgcaatgca |
49055029 |
T |
 |
| Q |
113 |
atgcaagtcaagtcttg |
129 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49055030 |
atgcaagtcaagtcttg |
49055046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University