View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14060_high_15 (Length: 474)
Name: NF14060_high_15
Description: NF14060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14060_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 40 - 456
Target Start/End: Complemental strand, 14327035 - 14326626
Alignment:
| Q |
40 |
atagtgctagctagctagaatatttggttatgttatgtaactttttcttannnnnnnnagtgttttctatgttttagttgtttcctttgttaatctagct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14327035 |
atagtgctagctagctagaatatttggttatgttatgtaactttttcttattttttttagtgttttctatgttttagttgtttcctttgttaatctagct |
14326936 |
T |
 |
| Q |
140 |
agagcttaatcgggtagtcaagactcaagagattatgttgtttttgtataaagaaataaacatgacatctttactatgcatgtttgatcttcttttagtt |
239 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14326935 |
agagcttaatcgggtagtcaaga-------gattatgttgtttttgtataaagaaataaacatgacatctttactatgcatgtttgatcttcttttagtt |
14326843 |
T |
 |
| Q |
240 |
ttgggttgtatttcttttgattttgtgtctctaaacatgaagagattctttctgctgaagttgtctagtgcatgtttattatctgcttcatttgatatgg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14326842 |
ttgggttgtatttcttttgattttgtgtctctaaacatgaagagattctttctgctgaagttgtctagtgcatgtttattatctgcttcatttgatatgg |
14326743 |
T |
 |
| Q |
340 |
taattgaatcttgtactccttactgttgatttattcaaatgtacgaaaatgaaatagtactatagtagcttgctgtgtctataatctatgcatgtgtgtc |
439 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14326742 |
taattgaatcttgtactccttattgttgatttattcaaatgtacgaaaatgaaatagtactatagtagcttgctgtgcctataatctatgcatgtgtgtc |
14326643 |
T |
 |
| Q |
440 |
actatccatgatcatag |
456 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14326642 |
cctatccatgatcatag |
14326626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University