View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14060_high_30 (Length: 230)
Name: NF14060_high_30
Description: NF14060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14060_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 139 - 223
Target Start/End: Complemental strand, 48287355 - 48287271
Alignment:
| Q |
139 |
tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48287355 |
tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatag |
48287271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University