View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14060_low_27 (Length: 250)
Name: NF14060_low_27
Description: NF14060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14060_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 31777856 - 31778016
Alignment:
| Q |
17 |
tcatacgaatttgtagtatatttttcctatgttacttcaagcaatattagaacctataacnnnnnnnngagggagttagaacctataagtgtatcatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
31777856 |
tcatacgaatttgtagtatatttttcctatgttacttcaagcaatattagaacctataacttttttttgatggagttaaaacctataagtgtatcatatt |
31777955 |
T |
|
| Q |
117 |
tt-atttctctcatttttatctttactactttaattaatattgatcattttacatggatgt |
176 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777956 |
tttatttctctcatttttatctttactactttaattaatattgatcattttacatggatgt |
31778016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 250
Target Start/End: Complemental strand, 16843930 - 16843863
Alignment:
| Q |
183 |
agctttatgagacaattatcttcggacagctgcagtaaaatgtagcgagactgcttgaatcagtatta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16843930 |
agctttatgagacaattatcttcggacagctgcagtaaaatgtagcgagactgcttgaatcagtatta |
16843863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University