View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14061_high_22 (Length: 246)
Name: NF14061_high_22
Description: NF14061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14061_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 12844558 - 12844663
Alignment:
| Q |
1 |
aatacaaaaaagtggtgatgagcatgttgaagatttatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844558 |
aatacaaaaaagtggtgatgagcatgttgaatatttatcttgatagattttattgatgcttttattttgagttggacttatgctttgaagaaagggaaaa |
12844657 |
T |
 |
| Q |
101 |
gaagaa |
106 |
Q |
| |
|
|||||| |
|
|
| T |
12844658 |
gaagaa |
12844663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 12844734 - 12844799
Alignment:
| Q |
177 |
cattttgtgagttggatcatgtact---gttctatgttttgaagaatgagagatgaagcaagtttt |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12844734 |
cattttgtgagttggatcatgtactactgttctatgttttgaagaatgagagatgaagcaagtttt |
12844799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University