View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14061_low_20 (Length: 300)
Name: NF14061_low_20
Description: NF14061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14061_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 48 - 282
Target Start/End: Complemental strand, 35413432 - 35413188
Alignment:
| Q |
48 |
gaaacggcaaaatttattcacgtcgaggaaatgcaaggagcagataaaaactcgcggataaagggaataaatataatgagatgccgcatatagacggaac |
147 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
35413432 |
gaaacggcaaaatttattcacatcgagaaactgcaaggagcagataaaaactcacggataaagggaataagtataatgaggtgccgcatatagacggaac |
35413333 |
T |
|
| Q |
148 |
accaccaccacaa----------gataaaaatggcatcaagcgatgaggccgagatatacttgctaacaccaagcatactcgtgcctcaccaatgaacag |
237 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
35413332 |
accaccaccccaaaacatcccaagataaaaatggcatcaagcgatgaggctgagatatacttgctaacaccaagcatacccctgcctcaccaatgaacag |
35413233 |
T |
|
| Q |
238 |
gccgagacacaccaacatagggaaaccgaactgctgcacaagaac |
282 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35413232 |
gccgagactcaccaacatagggaaaccgaactgctgcacaagaac |
35413188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 256
Target Start/End: Original strand, 4787843 - 4787930
Alignment:
| Q |
169 |
tggcatcaagcgatgaggccgagatatacttgctaacaccaagcatactcgtgcctcaccaatgaacaggccgagacacaccaacata |
256 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| || |||||||||||| | ||||||| | ||||| |||| | || |||||||||| |
|
|
| T |
4787843 |
tggcatcaagaaatgaggccgaaatatacttgttagcaccaagcatacccctgcctcagctttgaactggccaaaactcaccaacata |
4787930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 11156011 - 11155965
Alignment:
| Q |
56 |
aaaatttattcacgtcgaggaaatgcaaggagcagataaaaactcgcgg |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
11156011 |
aaaatttattcacgtcgagtaaatgcaaggcgc--ataaaaactcgcgg |
11155965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University