View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14061_low_25 (Length: 244)
Name: NF14061_low_25
Description: NF14061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14061_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 26 - 228
Target Start/End: Complemental strand, 5386221 - 5386019
Alignment:
| Q |
26 |
agggaccaacaaaataattaaacctattgtaaatatagaactcatgtagttgaaaatttcccttaaaaatacttactgtcgaaaacttgaagggaatatt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5386221 |
agggaccaacaaaataattaaacctattgtaaatatagaactcatgtagttgaaaatttcccttaaaaatacttactgtcgaaaacttgaagggaatatt |
5386122 |
T |
 |
| Q |
126 |
ataaaatgggattnnnnnnntctcatgagagtcttatatttagggatgcagcagcaaaatttaattattatccatgagaaatataaatcaacacattctt |
225 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5386121 |
ataaaatgggataaaaaaaatctcatgagagtcttatatttagggatgcagcagcaaaatttaattattatccatgagaaatataaatcaacacattctt |
5386022 |
T |
 |
| Q |
226 |
ttt |
228 |
Q |
| |
|
||| |
|
|
| T |
5386021 |
ttt |
5386019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University