View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14062_high_3 (Length: 390)

Name: NF14062_high_3
Description: NF14062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14062_high_3
NF14062_high_3
[»] chr7 (1 HSPs)
chr7 (146-325)||(1788926-1789110)


Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 146 - 325
Target Start/End: Original strand, 1788926 - 1789110
Alignment:
146 ctatgattgctaacaacatttttatatgagatgcttactaagataaactaaacacttcggtgagataaagggaaaaacacaatctattgagataaactaa 245  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||    
1788926 ctatgattgctaacaacatttttatatgagatgcttactaagataaactaaacacttcggtgagagaaagggaaaaacacaacctattgagataaactaa 1789025  T
246 aattattattaaatatc-----tgtaaaaatacgagatatttcataattaattttaattttacgtaagggtttcttgtaacattt 325  Q
    |||||||||||||||||     ||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||    
1789026 aattattattaaatatctcgtatgtaaaaatacgaaatatttaataattaattttaattttacataagggtttcttgtaacattt 1789110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University