View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14062_low_6 (Length: 390)
Name: NF14062_low_6
Description: NF14062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14062_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 146 - 325
Target Start/End: Original strand, 1788926 - 1789110
Alignment:
| Q |
146 |
ctatgattgctaacaacatttttatatgagatgcttactaagataaactaaacacttcggtgagataaagggaaaaacacaatctattgagataaactaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
1788926 |
ctatgattgctaacaacatttttatatgagatgcttactaagataaactaaacacttcggtgagagaaagggaaaaacacaacctattgagataaactaa |
1789025 |
T |
 |
| Q |
246 |
aattattattaaatatc-----tgtaaaaatacgagatatttcataattaattttaattttacgtaagggtttcttgtaacattt |
325 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1789026 |
aattattattaaatatctcgtatgtaaaaatacgaaatatttaataattaattttaattttacataagggtttcttgtaacattt |
1789110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University