View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14063_high_12 (Length: 255)
Name: NF14063_high_12
Description: NF14063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14063_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 15149883 - 15150121
Alignment:
| Q |
1 |
tacgattaaaaatatgaaccttcaatttatggcattcattcagaccacaaaatttgataaaagaaaaccctttatacttgtgttagtcaaaccgaaagtg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15149883 |
tacgattcaaaatatgaaccttcaatttatggcattcattcagaccacaaaatttgataaaagaaaaccctttatacttgtgttagtccaaccgaaagtg |
15149982 |
T |
 |
| Q |
101 |
attgatcaagccttttatgaacattacacgtagcaatcactagctagggattggtcaagctattggaagatctatatggtgatgatgatgaagataaaag |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15149983 |
atcgatcaagccttttatgaacattacacgtagcaatcactagctagggattggtcaagctattggaagatctatatggtgatgatgatgaagataaaag |
15150082 |
T |
 |
| Q |
201 |
tccttcatcatatacagttaatgtgatacagatgttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15150083 |
tccttcatcatatacagttaatgtgatacagatgttcat |
15150121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University