View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14063_low_14 (Length: 248)
Name: NF14063_low_14
Description: NF14063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14063_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 14065786 - 14066003
Alignment:
| Q |
18 |
agattaacaaaataaacctcggagcaaagaagtgatatgaacgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065786 |
agattaacaaaataaacctcggagcaaagaagtgatatgaatgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgag |
14065885 |
T |
 |
| Q |
118 |
aaatcagctactaactgtcataactgaaaagctagaaatgcgggaaattcataactaactgatactgctagataactaactaacaggttgctaatcactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065886 |
aaatcagctactaactgtcataactgaaaagctagaaatgcgggaaattcataactaactaaaactgctagataactaactaacaggttgctaatcactt |
14065985 |
T |
 |
| Q |
218 |
atcattgctacttatcag |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14065986 |
atcattgctacttatcag |
14066003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University