View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14064_low_3 (Length: 350)
Name: NF14064_low_3
Description: NF14064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14064_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 18 - 335
Target Start/End: Original strand, 2408631 - 2408950
Alignment:
| Q |
18 |
gctttcaagaatgttctttttggaaccgtcattgatggtgcttacatctctgcggctacaannnnnnnaatgattactttaagtttaagaaac--acaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||| |
|
|
| T |
2408631 |
gctttcaagaatgttctttttggaaccgtcattgatggtgcttacatctctgcggctacaatttttttaatgattactttaagtttaagaaactaaaaaa |
2408730 |
T |
|
| Q |
116 |
agagccggcataaaacatactttgagacaaatcaaattacttacatattctcacaaggcgctgaagagttttccttgtcatcattctcattaagttgaat |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2408731 |
aaagccggcataaaacatactttgagacaaatcaaattacttacatattctcacaaggcgctgaagagttttccttgtcatcattctcattaagttgaat |
2408830 |
T |
|
| Q |
216 |
atcattttctttatcatcagaagacattgaacttcctacagcctttctctttttggcttcaggaattcttctcttgtgtgagactgtgatccttttctct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2408831 |
ctcattttctttatcatcagaagacattgaacttcctacagcctttctctttttggcttcaggaattcttctcttgtgtgagactgtgatccttttctct |
2408930 |
T |
|
| Q |
316 |
tcattttcactctcatcaat |
335 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
2408931 |
tcattttcactctcttcaat |
2408950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University