View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14065_low_10 (Length: 298)
Name: NF14065_low_10
Description: NF14065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14065_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 37893932 - 37893806
Alignment:
| Q |
1 |
tttaattcctcagctttaccttttcccttcctttgagacacttcttcaatttctttctttggttcttgttgcactacttgttttttctgatcagaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37893932 |
tttaattcctcagctttaccttttcccttcctttgagacacttcttcaatttctttctttggttcttgttgcactacttgttttttctgatcagaaactt |
37893833 |
T |
|
| Q |
101 |
gaggagcagtgtttggtttctgaggaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37893832 |
gaggagcagtgtttggtttctgaggaa |
37893806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 37189030 - 37188904
Alignment:
| Q |
1 |
tttaattcctcagctttaccttttcccttcctttgagacacttcttcaatttctttctttggttcttgttgcactacttgttttttctgatcagaaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
37189030 |
tttaattcctcagctttaccttttcccttcctttgagacacttcttcaatttctttgtttggttcttgatgtactacttgttttttctgatcagaaactt |
37188931 |
T |
|
| Q |
101 |
gaggagcagtgtttggtttctgaggaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37188930 |
gaggagcagtgtttggtttctgaggaa |
37188904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 205 - 283
Target Start/End: Complemental strand, 37893728 - 37893650
Alignment:
| Q |
205 |
ctgatgagttttggaagcttaatatataagattccagcttcaaatttggcaccaatgttatttgtatcagaatgaggtg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37893728 |
ctgatgagttttggaagcttaatatataagattccagcttcaaatttggcaccaatgttatttgtatcagaatgaggtg |
37893650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 206 - 283
Target Start/End: Complemental strand, 37188825 - 37188748
Alignment:
| Q |
206 |
tgatgagttttggaagcttaatatataagattccagcttcaaatttggcaccaatgttatttgtatcagaatgaggtg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37188825 |
tgatgagttttggaagcttaatatataagattccagcttcaaatttggcaccaatgttatttgtatcagaatgaggtg |
37188748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University