View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14065_low_12 (Length: 235)
Name: NF14065_low_12
Description: NF14065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14065_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 38390275 - 38390490
Alignment:
| Q |
1 |
aaaaaaccaagcacatgctcacacggacgccgggtacacaatatgtccctcgaagagtatgtgtcctttaaatcttgatgtgcttctatcgcattccaca |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38390275 |
aaaaaaccaagcacatgcttacacggacgccgggtacacaatatgtccctcgaagagtatgtgtcctttaaatcttgatgtgcttctatcgcattgcaca |
38390374 |
T |
|
| Q |
101 |
cagttatgactcttcaatctgcatatcttgttcttgttgatgccctacccccggaaatttccaacctgacattcttccagtttttcacttttgttgttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38390375 |
cagttatgactcttcaatctgcatatcttgttcttgttgatgccctacccccggaaatttccaacctgacattcttccagtttttcacttttgttgttgt |
38390474 |
T |
|
| Q |
201 |
tgctgttattgtattt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38390475 |
tgctgttattgtattt |
38390490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 38390784 - 38390878
Alignment:
| Q |
8 |
caagcacatgctcacacggacgccgggtacacaatatgtccctcgaagagtatgtgtcctttaaatcttgatgtgcttctatcgcattccacacag |
103 |
Q |
| |
|
|||||||||||||||| | || || |||||||||||||||||| ||||||||| ||||||||| | |||||||||||||| ||||| ||||||| |
|
|
| T |
38390784 |
caagcacatgctcacatgaac-cctagtacacaatatgtccctcagagagtatgtttcctttaaagcatgatgtgcttctattgcattgcacacag |
38390878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University