View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14067_high_2 (Length: 301)
Name: NF14067_high_2
Description: NF14067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14067_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 20 - 184
Target Start/End: Complemental strand, 47875271 - 47875111
Alignment:
| Q |
20 |
ctgttctcttctgttagagtttcataacaatgcttcagtgcctcacagtccacttctgtttgtttcacctttgtcctgcatatattatatcttaattaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875271 |
ctgttctcttctgttagagtttcataacaatgcttcagtgcctcacagtccacttctgtttgtttcacctttgtcctgcatatattatatcttaattaaa |
47875172 |
T |
 |
| Q |
120 |
catgattattacatatatataagaattttatttgtatgcacctacgtcgtgtaacatgcatttaa |
184 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47875171 |
catgattattaca----tataagaattttatttgtatgcacctacgttgtgtaacatgcatttaa |
47875111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 186 - 299
Target Start/End: Complemental strand, 47875045 - 47874932
Alignment:
| Q |
186 |
gagaataatgattgtaaatatagaattacaaccttgccctcctgttctgaaaccacacctccacttgtctcgtcccaagattcagcttgcttgccaattc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875045 |
gagaataatgattgtaaatatagaattacaaccttgccctcctgttctgaaaccacacctccacttgtctcgtcccaagattcagcttgcttgccaattc |
47874946 |
T |
 |
| Q |
286 |
ttgcctttgcttct |
299 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
47874945 |
ttgcttttgcttct |
47874932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University