View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1406_high_13 (Length: 360)

Name: NF1406_high_13
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1406_high_13
NF1406_high_13
[»] chr1 (1 HSPs)
chr1 (84-118)||(31867824-31867858)


Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 118
Target Start/End: Complemental strand, 31867858 - 31867824
Alignment:
84 tgcccattaacagagctctttcacaaacaaacaaa 118  Q
    |||||||||||||||||||||||||||||||||||    
31867858 tgcccattaacagagctctttcacaaacaaacaaa 31867824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University