View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1406_high_14 (Length: 359)
Name: NF1406_high_14
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1406_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 118
Target Start/End: Complemental strand, 31867858 - 31867824
Alignment:
| Q |
84 |
tgcccattaacagagctctttcacaaacaaacaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31867858 |
tgcccattaacagagctctttcacaaacaaacaaa |
31867824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University