View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1406_high_27 (Length: 257)
Name: NF1406_high_27
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1406_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 41 - 147
Target Start/End: Original strand, 31087102 - 31087208
Alignment:
| Q |
41 |
cacgtctactcttgtaccatccggggtcataaataatttacagcacatatgcttcagtcagaatcagattcctcgtgtaaaaggagcaaagcaaatgcca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31087102 |
cacgtctactcttgtaccatccggggtcataactaatttacagcacatatgcttcagtcagaatcagattcctcgtgtaaaaggagcaaagcaaatgcca |
31087201 |
T |
 |
| Q |
141 |
caatcaa |
147 |
Q |
| |
|
||||||| |
|
|
| T |
31087202 |
caatcaa |
31087208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University