View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1406_low_26 (Length: 318)
Name: NF1406_low_26
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1406_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 84 - 216
Target Start/End: Original strand, 33840784 - 33840916
Alignment:
| Q |
84 |
agatacggcggagcaaaccggtggccggaacgtgttcacggtgtcgcagtggtgccagtgtagctgatatgattacacaaacaagattttgttatgttcc |
183 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840784 |
agatacggcggagcaaaccggtggcgggaacgtgttcacggtgtcgcagtggtgccagtgtagctgatatgattacacaaacaagattttgttatgttcc |
33840883 |
T |
|
| Q |
184 |
tttctattgtaaatcttggaaagctattttatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33840884 |
tttctattgtaaatcttggaaagctattttatg |
33840916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University