View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1406_low_28 (Length: 316)
Name: NF1406_low_28
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1406_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 255
Target Start/End: Complemental strand, 28267457 - 28267206
Alignment:
| Q |
5 |
ccacgtggaccaataagggattgacatttcggaaaggatattcgtatgttgaagttcgtgtcaatcaccgttgcattgctgacgcgtggtaatgcgatta |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28267457 |
ccacgtggaccaataagagattgacatttcggaaaggatattcgtatgttgaagttcgtgttgatcaccgttgcattgctgacgcgtggtaatgcgttta |
28267358 |
T |
 |
| Q |
105 |
cgcaagccgtagatcgtacattttccnnnnnnnggaaaat-aaaaatggcgcttcttttaaattatcgcgaggactgcgccgcgaatatgcgcactcgcg |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267357 |
cgcaagccgtagatcgtacattttcctttttttggaaaataaaaaatggcgcttcttttaaattatcgcgaggactgcgccgcgaatatgcgcactcgcg |
28267258 |
T |
 |
| Q |
204 |
ccttgtttattgtcttatatgccccccttttatatttttgcctttgtttctt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28267257 |
ccttgtttattgtcttatatgccccccttttatatttttgcctttttttctt |
28267206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University