View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1406_low_37 (Length: 201)

Name: NF1406_low_37
Description: NF1406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1406_low_37
NF1406_low_37
[»] chr2 (1 HSPs)
chr2 (1-117)||(45689969-45690085)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 45689969 - 45690085
Alignment:
1 tgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45689969 tgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctat 45690068  T
101 tgctcatcttcctcttc 117  Q
    |||||||||||||||||    
45690069 tgctcatcttcctcttc 45690085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University