View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14072_low_7 (Length: 415)
Name: NF14072_low_7
Description: NF14072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14072_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 330 - 400
Target Start/End: Original strand, 51099386 - 51099456
Alignment:
| Q |
330 |
tttgatttgattggccacccataatcacaatgtggatcacaatttacaccatctctagtagactataaaat |
400 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51099386 |
tttgatttgattggtcacccataatcacaatgtggatcacaatttacaccgtctctagtagactataaaat |
51099456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University