View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14072_low_9 (Length: 361)
Name: NF14072_low_9
Description: NF14072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14072_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 11 - 346
Target Start/End: Original strand, 3125024 - 3125360
Alignment:
| Q |
11 |
taattttttgttctaatcggatattctttgctaacaacaagcgaaactcatccctagagttgggtagtaacacattaagcaacaaaactatatctcaaga |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3125024 |
taattttttgttttaatcggatattctttgctcacaacaagtgaaactaatccctagagttgggtagtaacacattaggcaacaaaactatatctcaaga |
3125123 |
T |
 |
| Q |
111 |
gtgttaatgttgctcattcttaggtaagtgtttgaaacttt-gacttttggttaagctaaaaaagacttttatcatctcatttaaatgctcttgaatcta |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3125124 |
gtgttaatgttgttcattcttaggtaagtgtttgaaacttttgacttttggttaagctaaaaaagacttttatcatctcatttaattgctcttgaatcta |
3125223 |
T |
 |
| Q |
210 |
tttttggttaatcgttttatttgttcacaggttaggttgcgttgatttcactagtagcaaaacttcacaatattcatcaaattgtatgaatcatgtatta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3125224 |
tttttggttaatcgttttatttgttcacaggttaggttgcattgatttcactagtagcaaaacttcacaatattcatcaaattgtatgaatcatgtatta |
3125323 |
T |
 |
| Q |
310 |
tctcattgctaaatacaaatgaatttcatgtatgttt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3125324 |
tctcattgctaaatacaaatgaatttcatgtatgttt |
3125360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 269 - 337
Target Start/End: Complemental strand, 3556719 - 3556651
Alignment:
| Q |
269 |
aaacttcacaatattcatcaaattgtatgaatcatgtattatctcattgctaaatacaaatgaatttca |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3556719 |
aaacttcacaatgttcatcaaattgtatgaatcatgtattatcccattgctaaatacaaatgattttca |
3556651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University