View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14073_low_1 (Length: 520)
Name: NF14073_low_1
Description: NF14073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14073_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 440; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 18 - 473
Target Start/End: Complemental strand, 35022152 - 35021697
Alignment:
| Q |
18 |
caagaaagatgaattagtatcggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgaggcggaggaaggtggaaaaggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35022152 |
caagaaagatgaattagtatcggagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgcggcggaggaaggtggaaaaggg |
35022053 |
T |
|
| Q |
118 |
gaagttacggcggtgacgaaggagaaggaagttgaaacggagattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaagga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022052 |
gaagttacggcggtgacgaaggagaaggaagttgaaacggagattttacgaataccgaggtcgcgaagggagatgtgaacgttggagatggcgggaagga |
35021953 |
T |
|
| Q |
218 |
ggttgttgatggattcagggtaaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021952 |
ggttgttgatggattcagggtaaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagat |
35021853 |
T |
|
| Q |
318 |
ccatgcacgtgcgatggagcggttagtagcgatgtgagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggatt |
417 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021852 |
ccatgcacgtgcgatggagcggttagtggcgatgggagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggatt |
35021753 |
T |
|
| Q |
418 |
atggatgggtcgggttcttcgagacggaggtgagtgagtttgagattttgcatggc |
473 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021752 |
atggatgggtcgggttcttcgagacggaggtgagtgagtttgagattttgcatggc |
35021697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 4e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 158 - 246
Target Start/End: Original strand, 42811487 - 42811575
Alignment:
| Q |
158 |
agattttacgaatgccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcagggtaaacgtcg |
246 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42811487 |
agattttatggatgccgaggtcgtgaagggagatgtgaacgttggagatggcggggaggaggttgttgatggattcagggtaaacgtcg |
42811575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University