View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14073_low_7 (Length: 305)
Name: NF14073_low_7
Description: NF14073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14073_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 287
Target Start/End: Complemental strand, 9200983 - 9200709
Alignment:
| Q |
13 |
attctctataatggaagtgttaacataaaatgaaaaataatataaaatgcatgtgtgtatgtcacatggcaatactcgaacgcctagtggatggatgttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9200983 |
attctctataatggaagtgttaacataaaatgaaaaataatataaaatgcatgtgtgtatgtcacatggcaatactcgaacgcctagtggatggatgttt |
9200884 |
T |
 |
| Q |
113 |
gatttcatttgatttgcttgaaatagtaaagtatacttttgaagaggtgtgaggtgatgaatttgaagtgtgaaaacttaatattagttagtcttataag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9200883 |
gatttcatttgatttgcttgaaatagtaaagtatacttttgaagaggtgtgaggtgatgaatttgaagtgtgaaaacttaatattagttagtcttataag |
9200784 |
T |
 |
| Q |
213 |
ttggggggctatggtgagagctcaaaaaccgtgaggatatatttttgaatatataaaggttatgttaggtggaaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9200783 |
ttggggggctatggtgagagctcaaaaaccgtgaggatatatttttgaatatataaaggttatgttaggtggaaa |
9200709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University