View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14075_high_13 (Length: 202)

Name: NF14075_high_13
Description: NF14075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14075_high_13
NF14075_high_13
[»] chr6 (1 HSPs)
chr6 (15-184)||(17301110-17301282)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 15 - 184
Target Start/End: Complemental strand, 17301282 - 17301110
Alignment:
15 gagatgaaacgttcagcttttctatttgtttcaactttggtctgggggagagggagaggggatttcagtgccgaggagttcttctgactcctcataggac 114  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17301282 gagatgaaacgttcagcttttctatttgtttcagctttggtctgggggagagggagaggggatttcagtgccgaggagttcttctgactcctcataggac 17301183  T
115 agttgtggttgc---ggaagacgagacggggagggtcatccagtactgaggagtagtttcgagacaggaatgt 184  Q
    ||||| ||| ||   || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
17301182 agttgcggtcgcggtggtagacgagacggggagggtcatccagtactgaggagtagtttcgagagaggaatgt 17301110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University