View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14075_high_3 (Length: 388)
Name: NF14075_high_3
Description: NF14075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14075_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 12 - 370
Target Start/End: Complemental strand, 28564360 - 28564003
Alignment:
| Q |
12 |
atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggacctgaagggattgtcga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
28564360 |
atcatcatggtatactaaatgacctgaagggattgttgacaacccctcattcacagttgggaaaaatcagacctaccaagggagctgaagggattgttga |
28564261 |
T |
|
| Q |
112 |
cagccccttattaacagttgggaaaaaccagattgtccaaatttaaata--atactatagcagctccaatccgacagcatgaacacagcgattaccacaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
28564260 |
cagccccttattaacagttgggaaaaaccagattgtccaaatttaaatacaatactatagcagctctaatccgacagcatgaacacagggattaccacaa |
28564161 |
T |
|
| Q |
210 |
tccaaattcatatttggggttcaatgaaatgttgttggcctgattattaaggtgtacaacatgataaatagcgaagggtgatgtgctcggcattggttta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28564160 |
tccaaattcatatttggggttcaatgaaatgttgttggcctgattattaaggtgtacaacatgataaatagcgaagggtgatgtgctcggcattggttta |
28564061 |
T |
|
| Q |
310 |
gattaatctattggttgttctgtattattggttacctttcaatatagtgtatgtttactgt |
370 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28564060 |
gattgatctattg---gttctgtattattggttgcctttcaatatagtgtatgtttactgt |
28564003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University