View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14075_low_10 (Length: 245)
Name: NF14075_low_10
Description: NF14075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14075_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 55068013 - 55068217
Alignment:
| Q |
19 |
agactcctaaccaagtatctctgaatgagggacactcaaaaaatgaatgacaaagcaactctgttacttcacaactattcacacaataatgagaattatc |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
55068013 |
agactcctaaccaagtatttctgaatgagagacactcaaaaaataaatgacaaagcaactctgttatttcacaaccattcacacaataatgagaattatc |
55068112 |
T |
 |
| Q |
119 |
atctaaagaaataccacacctgtgtaaattctccttttttggtaacctggtatttataaaacgccaagtataaaaagagaccttcaatggagtgatttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55068113 |
atctaaagaaataccacacctgtgtaaattctccttttttggtaacctggtatttagaaaacgccaagtatacaaagagaccttcaatggagtgatttta |
55068212 |
T |
 |
| Q |
219 |
tttga |
223 |
Q |
| |
|
||||| |
|
|
| T |
55068213 |
tttga |
55068217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University