View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14075_low_12 (Length: 215)
Name: NF14075_low_12
Description: NF14075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14075_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 10458784 - 10458968
Alignment:
| Q |
14 |
agaatatcaataaatgcttaaacacgcaatcaaaacgaaaggctccagataccaannnnnnnggaacaatcaaggttgcaatgattgcttagacaccaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10458784 |
agaatatcaataaatgcttaaacacgatatcaaaacgaaaggctccggataccaatttttttggaacaatcaaggttgcaatgattgcttagacaccaat |
10458883 |
T |
|
| Q |
114 |
aaagaagaaagttctatattatgagagtaatattatggagagtttttcacaaaatttttattgcattatgtagtgaagcatgtac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10458884 |
aaagaagaaagttctatattatgagagtaatattatggagagtttttcacaaaatttttattgcattaagtagtgaagcatgtac |
10458968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University